pLSLGFP
(Plasmid #51494)

• Purpose: pLSL with GFP followed by the us:NPTII repair template, Rep is not included on this plasmid
• Depositing Lab: Daniel Voytas
• Publication: Baltes et al Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792

Backbone

• Vector backbone: pCAMBIA1300
• Backbone size w/o insert (bp): 12921
• Total vector size (bp): 15157
• Modifications to backbone: cis-acting replicational elements from the bean yellow dwarf virus were added in an LIR-SIR-LIR orientation.
• Vector type: plant T-DNA plasmid
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: GFP
• Species: jellyfish
• Insert Size (bp): 912
• Promoter: virion-sense LIR and 2x35S
• Tags / Fusion Proteins:
  • NLS (N terminal on insert)
  • flag (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gateway Cloning
• 5′ sequencing primer: atggattataaggatcacgatg
• 3′ sequencing primer: taaagctcatcatgtttgtat

Gene/Insert 2

• Gene/Insert name: us:NPTII repair template
• Insert Size (bp): 2600

Cloning Information for Gene/Insert 2

• Cloning method: Gateway Cloning
• 5′ sequencing primer: agcagtcttacttccatgattt
• 3′ sequencing primer: taacatagatgacaccgcg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: I generated GFP and us:NPTII using other plasmids. us:NPTII was amplified using pDW1269 as a template. GFP was amplified using pTC23.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry