Skip to main content
Addgene

pLSLGFP
(Plasmid #51494)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51494 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAMBIA1300
  • Backbone size w/o insert (bp) 12921
  • Total vector size (bp) 15157
  • Modifications to backbone
    cis-acting replicational elements from the bean yellow dwarf virus were added in an LIR-SIR-LIR orientation.
  • Vector type
    plant T-DNA plasmid
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    GFP
  • Species
    jellyfish
  • Insert Size (bp)
    912
  • Promoter virion-sense LIR and 2x35S
  • Tags / Fusion Proteins
    • NLS (N terminal on insert)
    • flag (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gateway Cloning
  • 5′ sequencing primer atggattataaggatcacgatg
  • 3′ sequencing primer taaagctcatcatgtttgtat
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    us:NPTII repair template
  • Insert Size (bp)
    2600

Cloning Information for Gene/Insert 2

  • Cloning method Gateway Cloning
  • 5′ sequencing primer agcagtcttacttccatgattt
  • 3′ sequencing primer taacatagatgacaccgcg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    I generated GFP and us:NPTII using other plasmids. us:NPTII was amplified using pDW1269 as a template. GFP was amplified using pTC23.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLSLGFP was a gift from Daniel Voytas (Addgene plasmid # 51494 ; http://n2t.net/addgene:51494 ; RRID:Addgene_51494)
  • For your References section:

    DNA Replicons for Plant Genome Engineering. Baltes NJ, Gil-Humanes J, Cermak T, Atkins PA, Voytas DF. Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792 10.1105/tpc.113.119792 PubMed 24443519
Commonly requested with: