pLSL
(Plasmid #51493)

• Purpose: (Empty Backbone) T-DNA destination plasmid. Contains the bean yellow dwarf virus cis-acting elements (LIR and SIR) in an LIR-SIR-LIR orientation. Contains attR1 and attR2 sites between the LIR and SIR sequence.
• Depositing Lab: Daniel Voytas
• Publication: Baltes et al Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792

Backbone

• Vector backbone: pCAMBIA1300
• Backbone size (bp): 12921
• Modifications to backbone: Inserted cis-acting replicational elements from the bean yellow dwarf virus in an LIR-SIR-LIR orientation.
• Vector type: plant T-DNA plasmid
• Promoter: virion-sense LIR and 2x35S
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Kanamycin, 25 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: High Copy

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: atatccagctgaacggtc
• 3′ sequencing primer: gtaagtttcacttcacacatt

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The sequence for the cis-acting bean yellow dwarf virus replicational elements synthesized on g-Blocks, primers, and long oligos. These elements were fused together before insertion into pCAMBIA1300.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note that there may be some minor discrepancies between Addgene's quality control sequence and the depositor's assembled sequence. These discrepancies are not in functionally relevant regions of the plasmid.