pREPK219H
(Plasmid #51492)

• Purpose: pREP with a mutation in the ATPase domain (K219H). This is predicted to result in loss of geminivirus replication.
• Depositing Lab: Daniel Voytas
• Publication: Baltes et al Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792

Backbone

• Vector backbone: pMDC32
• Backbone size w/o insert (bp): 10000
• Total vector size (bp): 11216
• Vector type: plant expression T-DNA
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Rep/RepA
• Species: bean yellow dwarf virus
• Insert Size (bp): 1000
• Mutation: changed lysine 219 to histidine
• GenBank ID: DQ458791
• Promoter: 2x35S

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: atgccttctgctagtaagaactt
• 3′ sequencing primer: aggcacgttcagtgactcga

Resource Information

• A portion of this plasmid was derived from a plasmid made by: I did not originally clone the gene. Rep/RepA coding sequence was synthesized on g-Blocks from IDT.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry