pETFH8
(Plasmid #51480)

• Purpose: Contains the effective Fh8 fusion tag enhancing the solubility of the target recombinant protein and increases its expression.
• Depositing Lab: Andre Almeida
• Publication: Costa et al Appl Microbiol Biotechnol. 2013 Aug;97(15):6779-91. doi: 10.1007/s00253-012-4559-1. Epub 2012 Nov 20.

Backbone

• Vector backbone: pET
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5260
• Total vector size (bp): 5914
• Modifications to backbone: Insertion of TEV recognition site and the FH8 solubilisation tag.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Use BL21 Codon Plus E. coli for expression
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Adiponectin
• Alt name: AdipoQ
• Alt name: Acrp30
• Species: M. musculus (mouse)
• Insert Size (bp): 414
• GenBank ID: JN960876
• Promoter: lacI
• Tag / Fusion Protein:
  • FH8 (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (destroyed during cloning)
• 3′ cloning site: XhoI (destroyed during cloning)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: CCGCTGAGCAATAACTAGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: We cloned this gene in house.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry