pHTN HaloTag CMV-neo/ERGIC2-variant
(Plasmid #51477)

• Purpose: Expresses ERGIC2-variant in mammalian cells, HaloTag for cellular localization
• Depositing Lab: Simon Kwok
• Publication: Kwok et al DNA Cell Biol. 2013 Dec 4.

Backbone

• Vector backbone: pHTN HaloTag CMV-neo
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 6143
• Total vector size (bp): 7290
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ERGIC2
• Alt name: PTX1
• Species: H. sapiens (human)
• Insert Size (bp): 1147
• Mutation: 4 base deletion at codon #189
• Entrez Gene: ERGIC2 (a.k.a. CDA14, Erv41, PTX1, cd002)
• Tag / Fusion Protein:
  • HaloTag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CCAACCACTGATGATCTGTAC
• 3′ sequencing primer: TCTTATCATGTCTGCTCGAAGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • HaloTag Vector Limited Use Label License
• Industry Terms:
  • Not Available to Industry