Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDON-AI-Npm2(N533)
(Plasmid #51475)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51475 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pDON-AI
  • Backbone manufacturer
    TAKARA
  • Backbone size w/o insert (bp) 5682
  • Total vector size (bp) 6354
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Nucleoplasmin 2
  • Alt name
    Npm2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    622
  • Mutation
    Eleven codons (5, 6, 7, 8, 10, 82, 95, 104, 184, 189, and 197) were substituted to Asp.
  • GenBank ID
    AY262112
  • Entrez Gene
    Npm2

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HpaI (destroyed during cloning)
  • 3′ cloning site HpaI (destroyed during cloning)
  • 5′ sequencing primer cggctattctcgcagctc
  • 3′ sequencing primer actttccacacctggttgct
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDON-AI-Npm2(N533) was a gift from Shunsuke Ishii (Addgene plasmid # 51475 ; http://n2t.net/addgene:51475 ; RRID:Addgene_51475)