TALEN-CCR5R18-CtermQ3
(Plasmid #51441)

• Purpose: Expresses TALEN targeting right CCR5A site (R18) with Q3 C-terminal domain
• Depositing Lab: David Liu
• Publication: Guilinger et al Nat Methods. 2014 Apr;11(4):429-35. doi: 10.1038/nmeth.2845. Epub 2014 Feb 16.

Backbone

• Vector backbone: JDS70
• Backbone manufacturer: Joung lab
• Backbone size w/o insert (bp): 5055
• Total vector size (bp): 8058
• Modifications to backbone: TAL N-terminal: ∆152 (Miller et al. 2011) TAL C-terminus: +63 (Miller et al. 2011) FOKI: KK
• Vector type: Mammalian Expression, TALEN

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TALEN CCR5 Right (R18) Q3 C-term
• Species: Synthetic
• Insert Size (bp): 3003
• Mutation: K788Q, R792Q and R801Q
• Promoter: CMV
• Tags / Fusion Proteins:
  • 3xFLAG (N terminal on insert)
  • Fok1 KK variant (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGG
• 3′ sequencing primer: GCTGATCAGCGGGTTTAAAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry