pAF1-VP64-SeqFosA
(Plasmid
#51430)
-
PurposeArtificial transcription factor with VP64 targeting c-Fos (TALE A)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51430 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAF1-VP64
- Backbone size w/o insert (bp) 7485
- Total vector size (bp) 8675
-
Modifications to backbonepAF1-VP64-SeqFosA was obtained by introduction of RVD in pAF1-VP64 (Cermak et al., 2011).
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSeqFosA
-
SpeciesSynthetic
-
Insert Size (bp)1172
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Esp3I (destroyed during cloning)
- 3′ cloning site Esp3I (destroyed during cloning)
- 5′ sequencing primer GCCGTTACAGTTGGACACAG
- 3′ sequencing primer TACGGCGATTGACTCTTCTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAF1-VP64-SeqFosA was a gift from Xavier Darzacq (Addgene plasmid # 51430 ; http://n2t.net/addgene:51430 ; RRID:Addgene_51430) -
For your References section:
Transcription Factors Modulate c-Fos Transcriptional Bursts. Senecal A, Munsky B, Proux F, Ly N, Braye FE, Zimmer C, Mueller F, Darzacq X. Cell Rep. 2014 Jun 25. pii: S2211-1247(14)00447-1. doi: 10.1016/j.celrep.2014.05.053. 10.1016/j.celrep.2014.05.053 PubMed 24981864