Skip to main content
Addgene

pAF1-VP64
(Plasmid #51427)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51427 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAF1
  • Backbone size (bp) 7372
  • Modifications to backbone
    The VP64 activator domain obtained by digestion with BamHI and XbaI of the PCR fragment (obtained with the primers ATCGGGATCCCGGACGGGCTGACGCATTGGA and ATCGTCTAGATTAGTTAATCAGCATGTCCAGGT) on the pAAV_TALE-TF(VP64)-BB_V3 plasmid (Addgene plasmid 42581) (Cong et al., 2012) was inserted into pAF1 (Addgene 51425) to obtain the pAF1-VP64 plasmid.
  • Vector type
    Mammalian Expression
  • Promoter CMV
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GGCTAACTAGAGAACCCACTG
  • 3′ sequencing primer GGCAACTAGAAGGCACAGTC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAF1-VP64 was a gift from Xavier Darzacq (Addgene plasmid # 51427 ; http://n2t.net/addgene:51427 ; RRID:Addgene_51427)

  • For your References section:

    Transcription Factors Modulate c-Fos Transcriptional Bursts. Senecal A, Munsky B, Proux F, Ly N, Braye FE, Zimmer C, Mueller F, Darzacq X. Cell Rep. 2014 Jun 25. pii: S2211-1247(14)00447-1. doi: 10.1016/j.celrep.2014.05.053. 10.1016/j.celrep.2014.05.053 PubMed 24981864
Related items:
Commonly requested with: