pGolden-AAV
(Plasmid
#51424)
-
PurposeContain AAV ITRs, lacZ expressing for blue-white selection for golden-gate reaction
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51424 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-MCS
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 2895
- Total vector size (bp) 3358
-
Modifications to backbonepAAV-MCS (t3689g, g3686c), CMV-MCS replaced with lacZ
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namelacZ
-
Insert Size (bp)463
- Promoter lacZ
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CTATCGAGACCGGCGCCGCTAC
- 3′ sequencing primer CGCCAGAGACCACCGGTGGAAAG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGolden-AAV was a gift from Yonglun Luo (Addgene plasmid # 51424 ; http://n2t.net/addgene:51424 ; RRID:Addgene_51424) -
For your References section:
Efficient construction of rAAV-based gene targeting vectors by Golden Gate cloning. Luo Y, Lin L, Bolund L, Sorensen CB. Biotechniques. 2014 May 1;56(5):263-8. doi: 10.2144/000114169. eCollection 2014 May. 10.2144/000114169 PubMed 24806227