Skip to main content
Addgene

EGFP-IC2-N237
(Plasmid #51410)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51410 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-C2
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4731
  • Total vector size (bp) 5400
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dynein intermediate chain IC2C
  • Alt name
    Dync1i2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    711
  • Mutation
    AA 1-237
  • Entrez Gene
    Dync1i2 (a.k.a. 3110079H08Rik, AW554389, Dnci, Dncic2)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ACCACCT GACAGATCTCAACCATGTC
  • 3′ sequencing primer GATTTAATGAAAGCTTAGCACCTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EGFP-IC2-N237 was a gift from Trina Schroer (Addgene plasmid # 51410 ; http://n2t.net/addgene:51410 ; RRID:Addgene_51410)
  • For your References section:

    Analysis of the dynein-dynactin interaction in vitro and in vivo. King SJ, Brown CL, Maier KC, Quintyne NJ, Schroer TA. Mol Biol Cell. 2003 Dec;14(12):5089-97. Epub 2003 Oct 17. 10.1091/mbc.e03-01-0025 PubMed 14565986