pIC291
(Plasmid #51403)

• Purpose: Retroviral expression of EGFP-TEV-S-tag SKA1 for protein localization and affinity purification (LAP)
• Depositing Lab: Iain Cheeseman
• Publication: Welburn et al Dev Cell. 2009 Mar;16(3):374-85. doi: 10.1016/j.devcel.2009.01.011.

Backbone

• Vector backbone: pIC242
• Backbone manufacturer: Addgene Plasmid # 44432
• Backbone size w/o insert (bp): 5977
• Total vector size (bp): 6763
• Modifications to backbone: Mob1A insert in pIC242 was removed and replaced by Ska1
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Ska1 IMAGE 3909951
• Alt name: C18orf24
• Species: H. sapiens (human)
• Insert Size (bp): 768
• Entrez Gene: SKA1 (a.k.a. C18orf24)
• Tags / Fusion Proteins:
  • EGFP (N terminal on backbone)
  • TEV protease site (N terminal on backbone)
  • S tag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: SacII (not destroyed)
• 5′ sequencing primer: GGCATGGACGAGCTGTACAAG
• 3′ sequencing primer: GCATTCATTTTATGTTTCAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry