KAP3-CT
(Plasmid
#51396)
-
Purposeexpression of EGFP-tagged COOH-terminal AA 661–793 KAP3B in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51396 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-C3
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 5100
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKinesin-associated protein 3
-
Alt nameKAP3B
-
SpeciesH. sapiens (human)
-
Insert Size (bp)400
-
GenBank IDNM_001204514
-
Entrez GeneKIFAP3 (a.k.a. FLA3, KAP-1, KAP-3, KAP3, SMAP, Smg-GDS, dJ190I16.1)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GATTATCTCGAGGAATATGATGAAGAATG
- 3′ sequencing primer CTAATAGAATTCTTATCAAGATCCATAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
KAP3-CT was a gift from Trina Schroer (Addgene plasmid # 51396 ; http://n2t.net/addgene:51396 ; RRID:Addgene_51396) -
For your References section:
Kinesin-2 is a motor for late endosomes and lysosomes. Brown CL, Maier KC, Stauber T, Ginkel LM, Wordeman L, Vernos I, Schroer TA. Traffic. 2005 Dec;6(12):1114-24. 10.1111/j.1600-0854.2005.00347.x PubMed 16262723