Skip to main content
Addgene

p7SL-neo-TET
(Plasmid #51285)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51285 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAluYa5-neo-TET
  • Backbone manufacturer
    Addgene plasmid 51283
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    7SL RNA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    413
  • GenBank ID
    M20910
  • Entrez Gene
    RN7SL2 (a.k.a. 7L1C, 7L30.1, 7SL1c, RNSRP2)
  • Promoter 7SL upstream pollII enhancer
  • Tag / Fusion Protein
    • neoTET cassette with a tetrahymena self-splicing intron interrupting the neo gene (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site AatII (not destroyed)
  • 5′ sequencing primer M13-pUC-Fwd
  • 3′ sequencing primer SV40pro-F
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

7SL is tagged with the self splicing intron neo cassette such that G418 resistance will be obtained only if retrotransposition occurs.

Primers used for amplification of 7SL:
GGATCCGCCCAGTGTGGGTGTGTCC
GACGTCAAGAGACGGGGTCTCGCTATG

Please note that the cassette is in the reverse orientation within the MCS relative to the full sequence--This has no functional consequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p7SL-neo-TET was a gift from Astrid Roy-Engel (Addgene plasmid # 51285 ; http://n2t.net/addgene:51285 ; RRID:Addgene_51285)
  • For your References section:

    The RNA polymerase dictates ORF1 requirement and timing of LINE and SINE retrotransposition. Kroutter EN, Belancio VP, Wagstaff BJ, Roy-Engel AM. PLoS Genet. 2009 Apr;5(4):e1000458. doi: 10.1371/journal.pgen.1000458. Epub 2009 Apr 24. 10.1371/journal.pgen.1000458 PubMed 19390602