Thy1.2-Roxed-Cre
(Plasmid #51276)

• Purpose: Expression of the Dre-dependent Roxed-Cre gene under the control of the Thy1.2 expression cassette
• Depositing Lab: Pawel Pelczar
• Publication: Hermann et al Nucleic Acids Res. 2014 Jan 9.

Backbone

• Vector backbone: pTS(2)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Roxed-Cre
• Promoter: Thy1.2

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (destroyed during cloning)
• 3′ cloning site: XhoI (destroyed during cloning)
• 5′ sequencing primer: GAATCCAAGTCGGAACTCTTGGC

Resource Information

• Supplemental Documents:
  • Annotated Genbank file
• A portion of this plasmid was derived from a plasmid made by: Based on Thy1 promoter construct (https://www.addgene.org/20736/)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry