Thy1.2-NLS_HA_Dre-P2A-BFP
(Plasmid #51275)

• Purpose: Co-expression of the site-specific recombinase Dre and BFP under the control of the Thy1.2 expression cassette
• Depositing Lab: Pawel Pelczar
• Publication: Hermann et al Nucleic Acids Res. 2014 Jan 9.

Backbone

• Vector backbone: pTS(2)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NLS_HA_Dre-P2A-BFP
• Promoter: Thy1.2

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: GAATCCAAGTCGGAACTCTTGGC

Resource Information

• Supplemental Documents:
  • Annotated Genbank file
• A portion of this plasmid was derived from a plasmid made by: Based on Thy1 promoter construct (https://www.addgene.org/20736/)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry