pCAG-Roxed-Cre
(Plasmid #51273)

• Purpose: Component of the Co-Driver binary site-specific recombinase system, generates functional rox60-71Cre upon removal of an internal STOP cassette by Dre
• Depositing Lab: Pawel Pelczar
• Publication: Hermann et al Nucleic Acids Res. 2014 Jan 9.

Backbone

• Vector backbone: pDIRECT
• Backbone manufacturer: CLONTECH
• Backbone size w/o insert (bp): 4814
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl2
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Roxed-Cre
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Esp3I (destroyed during cloning)
• 3′ cloning site: Esp3I (destroyed during cloning)
• 5′ sequencing primer: CATGCCTTCTTCTTTTTCCTAC
• 3′ sequencing primer: GGAAAGGACAGTGGGAGTGGC

Resource Information

• Supplemental Documents:
  • Annotated Genbank file
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the complementary plasmid pCAG-NLS-HA-Dre (www.addgene.org/51272) must be ordered with pCAG-Roxed-Cre in order to successfully use the Co-Driver recombinase system as described in the associated publication.