-
PurposeExpresses 3xFLAG-dCas9 in mammalian cells for enChIP analysis to purify specific genomic regions of interest.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51260 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMXs-neo
-
Backbone manufacturerHodaka Fujii
- Backbone size w/o insert (bp) 6238
- Total vector size (bp) 10450
-
Vector typeMammalian Expression, Retroviral, CRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert name3xFLAG-dCas9
-
SpeciesSynthetic
-
Insert Size (bp)4212
-
Mutationhuman codon-optimized, D10A + H840A
- Promoter LTR
-
Tags
/ Fusion Proteins
- 3xFLAG tag (N terminal on insert)
- NLS (nuclear localization signal) (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Pac I (not destroyed)
- 3′ cloning site Not I (not destroyed)
- 5′ sequencing primer ggtggaccatcctctagact
- 3′ sequencing primer tggggactttccacaccctaactgacacacat (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The coding sequence of 3xFLAG-dCas9 can be cleaved with Pac I and Not I.
Construction strategy of gRNA retroviral vectors
1. Cleave gBlock from a gRNA vector constructed using gRNA cloning vector (Addgene #41824) with appropriate restriction enzymes (eg. [Xho I + Hind III], EcoR I).
2. Insert the cleaved gBlock into pSIR-based self-inactivating retroviral vectors.
Vectors & Sites of insertion
pSIR-neo (Addgene #51128): eg. [Xho I + Hind III]
pSIR-GFP (Addgene #51134): eg. [Xho I + Hind III], EcoR I
pSIR-DsRed-Express2 (Addgene #51135): eg. [Xho I + Hind III], EcoR I
pSIR-hCD2 (Addgene #51143): eg. EcoR I
For more information on Fujii Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/fujii/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
3xFLAG-dCas9/pMXs-neo was a gift from Hodaka Fujii (Addgene plasmid # 51260 ; http://n2t.net/addgene:51260 ; RRID:Addgene_51260) -
For your References section:
Identification of Proteins Associated with an IFNgamma-Responsive Promoter by a Retroviral Expression System for enChIP Using CRISPR. Fujita T, Fujii H. PLoS One. 2014 Jul 22;9(7):e103084. doi: 10.1371/journal.pone.0103084. eCollection 2014. 10.1371/journal.pone.0103084 PubMed 25051498