3xFLAG-dCas9/pMXs-puro
(Plasmid #51240)

• Purpose: Expresses 3xFLAG-dCas9 in mammalian cells for enChIP analysis to purify specific genomic regions of interest.
• Depositing Lab: Hodaka Fujii
• Publication: Fujita et al PLoS One. 2014 Jul 22;9(7):e103084. doi: 10.1371/journal.pone.0103084. eCollection 2014.

Backbone

• Vector backbone: pMXs-puro
• Backbone manufacturer: Hodaka Fujii
• Backbone size w/o insert (bp): 5791
• Total vector size (bp): 10003
• Vector type: Mammalian Expression, Retroviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: slow growing, culture for 18hrs.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: 3xFLAG-dCas9
• Species: Synthetic
• Insert Size (bp): 4212
• Mutation: human codon-optimized, D10A + H840A
• Promoter: LTR
• Tags / Fusion Proteins:
  • 3xFLAG tag (N terminal on insert)
  • NLS (nuclear localization signal) (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamH I (not destroyed)
• 3′ cloning site: EcoR I (not destroyed)
• 5′ sequencing primer: ggtggaccatcctctagact
• 3′ sequencing primer: tggggactttccacaccctaactgacacacat

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The coding sequence of 3xFLAG-dCas9 can be cleaved with Pac I and Not I.

Construction strategy of gRNA retroviral vectors
1. Cleave gBlock from a gRNA vector constructed using gRNA cloning vector (Addgene #41824) with appropriate restriction enzymes (eg. [Xho I + Hind III], EcoR I).
2. Insert the cleaved gBlock into pSIR-based self-inactivating retroviral vectors.

Vectors & Sites of insertion
pSIR-neo (Addgene #51128): eg. [Xho I + Hind III]
pSIR-GFP (Addgene #51134): eg. [Xho I + Hind III], EcoR I
pSIR-DsRed-Express2 (Addgene #51135): eg. [Xho I + Hind III], EcoR I
pSIR-hCD2 (Addgene #51143): eg. EcoR I

For more information on Fujii Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/fujii/