-
PurposeExpresses hCas9 under the CAG promoter for CRISPR
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51142 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerclontech
- Backbone size w/o insert (bp) 5800
- Total vector size (bp) 9960
-
Modifications to backboneCMV promoter is replaced with CAG promoter.
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehCas9
-
Insert Size (bp)4160
- Promoter CAG
-
Tag
/ Fusion Protein
- SV40 NLS (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Kpn I (not destroyed)
- 3′ cloning site Not I (not destroyed)
- 5′ sequencing primer CGGCTTCTGGCGTGTGACC
- 3′ sequencing primer TTGCATTCATTTTATGTTTCAGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byhCas9 (Addgene: 41815) CAG promoter from Dr. Jun-ichi Miyazaki
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-hCas9 was a gift from Izuho Hatada (Addgene plasmid # 51142 ; http://n2t.net/addgene:51142 ; RRID:Addgene_51142) -
For your References section:
Generation of an ICF syndrome model by efficient genome editing of human induced pluripotent stem cells using the CRISPR system. Horii T, Tamura D, Morita S, Kimura M, Hatada I. Int J Mol Sci. 2013 Sep 30;14(10):19774-81. doi: 10.3390/ijms141019774. 10.3390/ijms141019774 PubMed 24084724
Map uploaded by the depositor.
