Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Cin85-3SH3-pCMV6-AN-GFP
(Plasmid #51137)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51137 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCMV6-AN-GFP
  • Backbone manufacturer
    Origene
  • Backbone size w/o insert (bp) 6600
  • Total vector size (bp) 7600
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cin85
  • Alt name
    SH3KBP1
  • Alt name
    SH3 domain-containing kinase-binding protein 1, transcript variant 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    996
  • Mutation
    contains 3 SH3 domains
  • GenBank ID
    NM_031892
  • Entrez Gene
    SH3KBP1 (a.k.a. AGMX2, CD2BP3, CIN85, GIG10, HSB-1, HSB1, IMD61, MIG18)
  • Promoter CMV
  • Tag / Fusion Protein
    • TurboGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SgfI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer Vector Primer v1.5 5' GGACTT TCCAAA ATG TCG 3'
  • 3′ sequencing primer Primer XL39 5’ ATTAGGACAAGGCTGGTGGG 3’
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments


How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Cin85-3SH3-pCMV6-AN-GFP was a gift from Agnieszka Swiatecka-Urban (Addgene plasmid # 51137 ; http://n2t.net/addgene:51137 ; RRID:Addgene_51137)