Cin85-3SH3-pCMV6-AN-GFP
(Plasmid
#51137)
-
PurposeExpress turbo GFP tagged three SH3 domains of Cin85 (truncation) in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51137 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV6-AN-GFP
-
Backbone manufacturerOrigene
- Backbone size w/o insert (bp) 6600
- Total vector size (bp) 7600
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCin85
-
Alt nameSH3KBP1
-
Alt nameSH3 domain-containing kinase-binding protein 1, transcript variant 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)996
-
Mutationcontains 3 SH3 domains
-
GenBank IDNM_031892
-
Entrez GeneSH3KBP1 (a.k.a. AGMX2, CD2BP3, CIN85, GIG10, HSB-1, HSB1, IMD61, MIG18)
- Promoter CMV
-
Tag
/ Fusion Protein
- TurboGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SgfI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer Vector Primer v1.5 5' GGACTT TCCAAA ATG TCG 3'
- 3′ sequencing primer Primer XL39 5’ ATTAGGACAAGGCTGGTGGG 3’ (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cin85-3SH3-pCMV6-AN-GFP was a gift from Agnieszka Swiatecka-Urban (Addgene plasmid # 51137 ; http://n2t.net/addgene:51137 ; RRID:Addgene_51137)
Map uploaded by Addgene staff.
![](https://media.addgene.org/data/easy-thumbnails/data/50/49/6fbe9786-7c66-11e3-b06b-000c298a5150.png.940x940_q85_autocrop.png)