AAV-EF1a-DIO-oChIEF(E163A/T199C)-P2A-dTomato-WPRE-BGHpA
(Plasmid #51094)

• Purpose: Cre dependent expression of oChIEF kinetic variant E163A/T199C with physically uncoupled dTomato fluorophore
• Depositing Lab: Jonathan Ting
• Publication: ChIEF and oChIEF AAV vectors (unpublished)

Backbone

• Vector backbone: pAAV-EF1a-DIO-WPRE-BGHpA
• Backbone manufacturer: custom
• Backbone size w/o insert (bp): 6095
• Total vector size (bp): 7175
• Modifications to backbone: Altered cloning sites and replaced HGHpA with smaller BGHpA
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: oChIEF(E163A/T199C)
• Alt name: oChIEFac
• Species: Synthetic
• Insert Size (bp): 1085
• Mutation: E163A/T199C
• Promoter: EF1a
• Tag / Fusion Protein:
  • P2A-dTomato (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: HpaI (not destroyed)
• 5′ sequencing primer: gccagcttggcacttgatgtaattctcc
• 3′ sequencing primer: CCATACGGGAAGCAATAGCATG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The original oChIEF portion was obtained from John Lin and Roger Tsien (UCSD/HHMI)
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The addition of the E163A and T199C mutations in oChIEF impart higher photocurrent amplitude while retaining fast kinetic properties. This variant is proposed as an alternative to ChETA variants that exhibit smaller photocurrents and more toxicity.