pAAV-CaMKIIa-oChIEF(E163A/T199C)-P2A-EGFP
(Plasmid #51093)

• Purpose: Forebrain principal neuron expression of oChIEF kinetic variant E163A/T199C with physically uncoupled EGFP fluorophore
• Depositing Lab: Jonathan Ting
• Publication: ChIEF and oChIEF AAV vectors (unpublished)

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV-CaMKIIa-WPRE-HGHpA
• Backbone manufacturer: custom
• Backbone size w/o insert (bp): 5100
• Total vector size (bp): 7253
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: oChIEF(E163A/T199C)
• Alt name: oChIEFac
• Species: Synthetic
• Insert Size (bp): 1085
• Mutation: E163A/T199C
• Promoter: CaMKIIa
• Tag / Fusion Protein:
  • P2A-EGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: HpaI (not destroyed)
• 5′ sequencing primer: aggagcacgggcaggcgagtgg
• 3′ sequencing primer: CCATACGGGAAGCAATAGCATG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The original oChIEF portion was obtained from John Lin and Roger Tsien (UCSD/HHMI)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The addition of the E163A and T199C mutations in oChIEF impart higher photocurrent amplitude while retaining fast kinetic properties. This variant is proposed as an alternative to ChETA variants that exhibit smaller photocurrents and more toxicity.