AAV-CaMKIIa-GCaMP6f-P2A-nls-dTomato
(Plasmid #51087)

• Purpose: Forebrain principle neuron specific expression of GCaMP6f Ca sensor and physically separate nuclear localized dTomato fluorophore
• Depositing Lab: Jonathan Ting
• Publication: Ting GCaMP6 plasmids (unpublished)

Backbone

• Vector backbone: pAAV-CaMKIIa-WPRE-BGHpA
• Backbone manufacturer: custom
• Backbone size w/o insert (bp): 5095
• Total vector size (bp): 7255
• Modifications to backbone: Altered cloning sites and replaced HGHpA with smaller BGHpA
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GCaMP6f
• Alt name: G6f
• Alt name: GCaMP6 fast
• Species: Synthetic
• Insert Size (bp): 2160
• Promoter: CaMKIIa 1.3 kb
• Tag / Fusion Protein:
  • P2A-nls-dTomato (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: AscI (not destroyed)
• 5′ sequencing primer: ttctccgtttgcactcaggagc
• 3′ sequencing primer: CCATACGGGAAGCAATAGCATG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The GCaMP6f portion was derived from Addgene plasmid #40755 (Douglas Kim, Janelia Farms).
• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The addition of the P2A-nls-dTomato allows for easy identification of GCaMP6 expressing cells exhibiting nuclear red fluorescence that does not significantly overlap with the cytosolic GCaMP signal. The GCaMP and fluorophore are physically uncoupled.

Permissions were obtained from Douglas Kim and the Clontech licensing office for depositing this new plasmid.