Skip to main content
Addgene

AAV-hSyn1-GCaMP6f-P2A-nls-dTomato
(Plasmid #51085)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51085 Standard format: Plasmid sent in bacteria as agar stab 1 $85
AAV1 51085-AAV1 Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. $405
AAV Retrograde 51085-AAVrg Virus (100µL at titer ≥ 7×10¹² vg/mL) and Plasmid. $405

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-hSyn1-WPRE-HGHpA
  • Backbone manufacturer
    Modified from Karl Deisseroth
  • Backbone size w/o insert (bp) 4590
  • Total vector size (bp) 6750
  • Modifications to backbone
    Altered cloning sites
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GCaMP6f
  • Alt name
    G6f
  • Alt name
    GCaMP6 fast
  • Species
    Synthetic
  • Insert Size (bp)
    2160
  • Promoter human Synapsin1
  • Tag / Fusion Protein
    • P2A-nls-dTomato (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer ctcagcgctgcctcagtctg
  • 3′ sequencing primer CCATACGGGAAGCAATAGCATG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The GCaMP6f portion was derived from Addgene plasmid #40755 (Douglas Kim, Janelia Farms).
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The addition of the P2A-nls-dTomato allows for easy identification of GCaMP6 expressing cells exhibiting nuclear red fluorescence that does not significantly overlap with the cytosolic GCaMP signal. The GCaMP and fluorophore are physically uncoupled.

Permissions were obtained from Douglas Kim and the Clontech licensing office for depositing this new plasmid.

Information for AAV1 (Catalog # 51085-AAV1) ( Back to top)

Purpose

Ready-to-use AAV1 particles produced from AAV-hSyn1-GCaMP6f-P2A-nls-dTomato (#51085). In addition to the viral particles, you will also receive purified AAV-hSyn1-GCaMP6f-P2A-nls-dTomato plasmid DNA.

GCaMP6f calcium sensor and bicistronic, physically separate nuclear localized dTomato expression under the Synapsin promoter. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
  • Buffer PBS + 0.001% Poloxamer 188 + 200 mM NaCl
  • Serotype AAV1
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene nuclear dTomato (physically separate, not a fusion protein)

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Information for AAV Retrograde (Catalog # 51085-AAVrg) ( Back to top)

Purpose

Ready-to-use AAV Retrograde particles produced from AAV-hSyn1-GCaMP6f-P2A-nls-dTomato (#51085). In addition to the viral particles, you will also receive purified AAV-hSyn1-GCaMP6f-P2A-nls-dTomato plasmid DNA.

GCaMP6f calcium sensor and bicistronic, physically separate nuclear localized dTomato expression under a human synapsin1 promoter. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV retrograde cap gene from rAAV2-retro helper (plasmid #81070)
  • Buffer PBS + 0.001% Poloxamer 188
  • Serotype AAV retrograde (AAVrg)
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene nuclear dTomato (physically separate, not a fusion protein)

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Retrograde functionality is dependent on high viral titers. Addgene recommends not diluting your AAV preps prior to use.

Data submitted about 51085-AAVrg by requesting scientist(s):

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-hSyn1-GCaMP6f-P2A-nls-dTomato was a gift from Jonathan Ting (Addgene plasmid # 51085 ; http://n2t.net/addgene:51085 ; RRID:Addgene_51085) For viral preps, please replace (Addgene plasmid # 51085) in the above sentence with: (Addgene viral prep # 51085-AAV1) or (Addgene viral prep # 51085-AAVrg)