Arch(D95H)-eGFP
(Plasmid #51081)

• Purpose: Expresses Arch(D95H)-eGFP in mammalian cells as a fluorescent reporter of membrane voltage
• Depositing Lab: Adam Cohen
• Publication: Park et al PLoS One. 2013 Dec 31;8(12):e85221. doi: 10.1371/journal.pone.0085221. eCollection 2013.

Backbone

• Vector backbone: FUGW (from Addgene plasmid 22051)
• Backbone manufacturer: Addgene plasmid 22051
• Backbone size w/o insert (bp): 9200
• Total vector size (bp): 10700
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: Use recombinase-free E. coli
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Archaerhodopsin-3 w/ D95H point mutation fused to eGFP
• Alt name: Arch(D95H)-eGFP
• Species: Halorubrum sodomense
• Insert Size (bp): 1500
• Mutation: Changed Aspartic Acid 95 to Histidine
• GenBank ID: BAA09452.1
• Promoter: Ubiquitin
• Tag / Fusion Protein:
  • eGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ttgaactatgcgctcggggttg
• 3′ sequencing primer: cggtgaacagctcctcgcccttg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: We received this gene (Archaerhodopsin-3) from the Boyden Lab at MIT; we made the D95H point mutation in Archaerhodopsin-3. This gene was inserted into Addgene plasmid 22051 cut with BamHI and AgeI.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that this plasmid was also described in Hou et al 2014 (PMID: 24507604) and Venkatachalam et al 2014 (PMID: 24428326).