pRS316-RGR-GFP-mm
(Plasmid #51059)

• Purpose: Same as pRS316-RGR-GFP except for the HH ribozyme region which has a 13 bp deletion at its 5' end, and for the HDV ribozyme region which has a 15 bp deletion at its 3' end.
• Depositing Lab: Yunde Zhao
• Publication: Gao et al J Integr Plant Biol. 2013 Dec 30. doi: 10.1111/jipb.12152.

Backbone

• Vector backbone: pRS316
• Backbone size w/o insert (bp): 4887
• Total vector size (bp): 5826
• Modifications to backbone: Yeast ADH1 promoter and ADH1 terminator were cloned in between the BamHI and EcoRI site, and RGR-GFP-mHDV gene was inserted inbetween the ADH1 promoter and terminator.
• Vector type: Bacterial Expression, Yeast Expression, CRISPR
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: RGR-GFP
• Species: Synthetic
• Insert Size (bp): 183
• Promoter: Yeast ADH1 promoter

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CCTCGTCATTGTTCTCGTTCC
• 3′ sequencing primer: ACGTATCTACCAACGATTTGACC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry