pRS316-RGR-GFP
(Plasmid #51056)

• Purpose: Express self-cleaving-ribozyme-flanked sgRNA cassette (RGR) targeting GFP for CRISPR systems in yeast driven by ADH1 promoter. RGR has a HH ribozyme at its 5', and an HDV ribozyme at its 3'.
• Depositing Lab: Yunde Zhao
• Publication: Gao et al J Integr Plant Biol. 2013 Dec 30. doi: 10.1111/jipb.12152.

Backbone

• Vector backbone: pRS316
• Backbone size w/o insert (bp): 4887
• Total vector size (bp): 5854
• Modifications to backbone: Yeast ADH1 promoter and ADH1 terminator were cloned in between the BamHI and EcoRI site, and RGR-GFP gene was inserted inbetween the ADH1 promoter and terminator.
• Vector type: Bacterial Expression, Yeast Expression, CRISPR
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: RGR-GFP
• Species: Synthetic
• Insert Size (bp): 211
• Promoter: Yeast ADH1 promoter

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CCTCGTCATTGTTCTCGTTCC
• 3′ sequencing primer: ACGTATCTACCAACGATTTGACC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry