Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRS316-RGR-GFP
(Plasmid #51056)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51056 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRS316
  • Backbone size w/o insert (bp) 4887
  • Total vector size (bp) 5854
  • Modifications to backbone
    Yeast ADH1 promoter and ADH1 terminator were cloned in between the BamHI and EcoRI site, and RGR-GFP gene was inserted inbetween the ADH1 promoter and terminator.
  • Vector type
    Bacterial Expression, Yeast Expression, CRISPR
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RGR-GFP
  • Species
    Synthetic
  • Insert Size (bp)
    211
  • Promoter Yeast ADH1 promoter

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CCTCGTCATTGTTCTCGTTCC
  • 3′ sequencing primer ACGTATCTACCAACGATTTGACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRS316-RGR-GFP was a gift from Yunde Zhao (Addgene plasmid # 51056 ; http://n2t.net/addgene:51056 ; RRID:Addgene_51056)
  • For your References section:

    Self-processing of ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for CRISPR-mediated genome editing. Gao Y, Zhao Y. J Integr Plant Biol. 2013 Dec 30. doi: 10.1111/jipb.12152. 10.1111/jipb.12152 PubMed 24373158