pACT2-CAS9c
(Plasmid #51055)

• Purpose: Express Eukaryotic-codon-optimized Cas9c gene in yeast under ADH1 promoter for genome editing. SV40 NLS is fused to the C terminal. GAL4 region from pACT2 is removed.
• Depositing Lab: Yunde Zhao
• Publication: Gao et al J Integr Plant Biol. 2013 Dec 30. doi: 10.1111/jipb.12152.

Backbone

• Vector backbone: pACT2
• Backbone manufacturer: Clonetech
• Backbone size w/o insert (bp): 8117
• Total vector size (bp): 11495
• Modifications to backbone: Sequences between the two HindIII sites are replaced by Cas9c. The GAL4 activation domain in the original vector was removed.
• Vector type: Bacterial Expression, Yeast Expression, CRISPR
• Selectable markers: LEU2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cas9c
• Alt name: Cas9
• Alt name: hCas9
• Alt name: hCas9c
• Species: Synthetic
• Insert Size (bp): 4140
• Promoter: yeast ADH1 promoter
• Tag / Fusion Protein:
  • SV40 NLS (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CCTCGTCATTGTTCTCGTTCC
• 3′ sequencing primer: ACGTATCTACCAACGATTTGACC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Luhan Yang from George M. Church Laboratory in Harvard Medical School.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry