Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pACT2-CAS9c
(Plasmid #51055)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51055 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pACT2
  • Backbone manufacturer
    Clonetech
  • Backbone size w/o insert (bp) 8117
  • Total vector size (bp) 11495
  • Modifications to backbone
    Sequences between the two HindIII sites are replaced by Cas9c. The GAL4 activation domain in the original vector was removed.
  • Vector type
    Bacterial Expression, Yeast Expression, CRISPR
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9c
  • Alt name
    Cas9
  • Alt name
    hCas9
  • Alt name
    hCas9c
  • Species
    Synthetic
  • Insert Size (bp)
    4140
  • Promoter yeast ADH1 promoter
  • Tag / Fusion Protein
    • SV40 NLS (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CCTCGTCATTGTTCTCGTTCC
  • 3′ sequencing primer ACGTATCTACCAACGATTTGACC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Luhan Yang from George M. Church Laboratory in Harvard Medical School.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pACT2-CAS9c was a gift from Yunde Zhao (Addgene plasmid # 51055 ; http://n2t.net/addgene:51055 ; RRID:Addgene_51055)
  • For your References section:

    Self-processing of ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for CRISPR-mediated genome editing. Gao Y, Zhao Y. J Integr Plant Biol. 2013 Dec 30. doi: 10.1111/jipb.12152. 10.1111/jipb.12152 PubMed 24373158