Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDisplay-DNER
(Plasmid #51053)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51053 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pDisplay
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5300
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DNER
  • Species
    M. musculus (mouse)
  • Mutation
    without endogenous signal peptide (1-221bp)
  • Entrez Gene
    Dner (a.k.a. A930026D19Rik, BET, Bret)
  • Promoter CMV
  • Tags / Fusion Proteins
    • signal peptide (N terminal on backbone)
    • HA (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer T7
  • 3′ sequencing primer pDisplay-rev (AACAACAGATGGCTGGCAAC)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pDisplay PDGFR Transmembrane domain is deleted.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDisplay-DNER was a gift from Mineko Kengaku (Addgene plasmid # 51053 ; http://n2t.net/addgene:51053 ; RRID:Addgene_51053)
  • For your References section:

    Delta/notch-like epidermal growth factor (EGF)-related receptor, a novel EGF-like repeat-containing protein targeted to dendrites of developing and adult central nervous system neurons. Eiraku M, Hirata Y, Takeshima H, Hirano T, Kengaku M. J Biol Chem. 2002 Jul 12;277(28):25400-7. Epub 2002 Apr 11. 10.1074/jbc.M110793200 PubMed 11950833