pDisplay-DNER
(Plasmid
#51053)
-
Purposeexpression of HA-DNER in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51053 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDisplay
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5300
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDNER
-
SpeciesM. musculus (mouse)
-
Mutationwithout endogenous signal peptide (1-221bp)
-
Entrez GeneDner (a.k.a. A930026D19Rik, BET, Bret)
- Promoter CMV
-
Tags
/ Fusion Proteins
- signal peptide (N terminal on backbone)
- HA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer T7
- 3′ sequencing primer pDisplay-rev (AACAACAGATGGCTGGCAAC) (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pDisplay PDGFR Transmembrane domain is deleted.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDisplay-DNER was a gift from Mineko Kengaku (Addgene plasmid # 51053 ; http://n2t.net/addgene:51053 ; RRID:Addgene_51053) -
For your References section:
Delta/notch-like epidermal growth factor (EGF)-related receptor, a novel EGF-like repeat-containing protein targeted to dendrites of developing and adult central nervous system neurons. Eiraku M, Hirata Y, Takeshima H, Hirano T, Kengaku M. J Biol Chem. 2002 Jul 12;277(28):25400-7. Epub 2002 Apr 11. 10.1074/jbc.M110793200 PubMed 11950833
Map uploaded by the depositor.
![](https://media.addgene.org/data/easy-thumbnails/data/62/46/58549198-77c7-11e3-ab14-000c29055998.pdf.940x940_q85_autocrop.png)