Skip to main content
Addgene

pLA CMV N-Flag RALB V23 R47
(Plasmid #50983)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50983 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLA
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RALB
  • Species
    H. sapiens (human)
  • Mutation
    G23V, K47R
  • Entrez Gene
    RALB
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer AACTCCTCATAAAGAGACAGC
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Orfeome

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLA CMV N-Flag RALB V23 R47 was a gift from Anna Sablina (Addgene plasmid # 50983 ; http://n2t.net/addgene:50983 ; RRID:Addgene_50983)

  • For your References section:

    The deubiquitylase USP33 discriminates between RALB functions in autophagy and innate immune response. Simicek M, Lievens S, Laga M, Guzenko D, Aushev VN, Kalev P, Baietti MF, Strelkov SV, Gevaert K, Tavernier J, Sablina AA. Nat Cell Biol. 2013 Oct;15(10):1220-30. doi: 10.1038/ncb2847. Epub 2013 Sep 22. 10.1038/ncb2847 PubMed 24056301
Related items: