pBBRBB-Ppuf843-1200-PR
(Plasmid #50963)

• Purpose: Expresses proteorhodopsin using the Ppuf843-1200 promoter segment, for use in R. sphaeroides
• Depositing Lab: Claudia Schmidt-dannert
• Publication: Tikh et al Appl Microbiol Biotechnol. 2014 Feb 9.

Backbone

• Vector backbone: pBBRBB
• Backbone size w/o insert (bp): 4500
• Total vector size (bp): 5100
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): JM109
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Proteorhodopsin
• Insert Size (bp): 780
• Promoter: Ppuf843-1200
• Tag / Fusion Protein:
  • 6xHis (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CATCCTGAACTTATCTAGACC
• 3′ sequencing primer: GCAGGTCCTGAAGTTAACTAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Johnson et al. 2010 Enhancement of Survival and Electricity Production in an Engineered Bacterium by Light-Driven Proton Pumping. AEM

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry