Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBBRBB-Ppuf843-1200-DsRed
(Plasmid #50962)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 50962 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBBRBB
  • Backbone size w/o insert (bp) 4300
  • Total vector size (bp) 5000
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    JM109
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    DsRed
  • Promoter Ppuf843-1200

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CATCCTGAACTTATCTAGACC
  • 3′ sequencing primer GCAGGTCCTGAAGTTAACTAG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBBRBB-Ppuf843-1200-DsRed was a gift from Claudia Schmidt-dannert (Addgene plasmid # 50962 ; http://n2t.net/addgene:50962 ; RRID:Addgene_50962)
  • For your References section:

    BioBrick compatible vector system for protein expression in Rhodobacter sphaeroides. Tikh IB, Held M, Schmidt-Dannert C. Appl Microbiol Biotechnol. 2014 Feb 9. 10.1007/s00253-014-5527-8 PubMed 24509770