pBBRBB-Ppuf843-1200-DsRed
(Plasmid
#50962)
-
PurposeExpressed DsRed using the Ppuf843-1200 promoter segment, for use in R. sphaeroides
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50962 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBBRBB
- Backbone size w/o insert (bp) 4300
- Total vector size (bp) 5000
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)JM109
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameDsRed
- Promoter Ppuf843-1200
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CATCCTGAACTTATCTAGACC
- 3′ sequencing primer GCAGGTCCTGAAGTTAACTAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBBRBB-Ppuf843-1200-DsRed was a gift from Claudia Schmidt-dannert (Addgene plasmid # 50962 ; http://n2t.net/addgene:50962 ; RRID:Addgene_50962) -
For your References section:
BioBrick compatible vector system for protein expression in Rhodobacter sphaeroides. Tikh IB, Held M, Schmidt-Dannert C. Appl Microbiol Biotechnol. 2014 Feb 9. 10.1007/s00253-014-5527-8 PubMed 24509770