ShuttleNSE
(Plasmid #50958)

• Purpose: (Empty Backbone) A backbone for adenovirus creation by the AdEasy method, similar to ShuttleCMV (Addgene Plasmid # 16403), except it uses a Neuron-specific enolase (NSE) promoter instead of the CMV promoter
• Depositing Lab: James Bamburg
• Publication: Mi et al PLoS One. 2013 Dec 31;8(12):e83609. doi: 10.1371/journal.pone.0083609.

Backbone

• Vector backbone: pShuttle
• Backbone manufacturer: Bert Vogelstein lab (Addgene Plasmid #16402)
• Backbone size (bp): 7981
• Modifications to backbone: A 1.1 kb portion of the rat NSE gene was PCR amplified using a forward primer containing AseI and AflII and a reverse primer containing BglII and PvuI sites. Primer sequences are as follows: GGGATTAATCTTAAGGGGACAGTAAAGGTGATGGC, 3’GGGAGATCTCGATCGGAGGACTGCAGACTCAGCC. The PCR product was digested with AseI and BglII and cloned into the AseI and BamHI cut pmRFP-N1 in place of the CMV promoter. The mRFP was removed from this plasmid with PvuI and XbaI and replaced with the PmeI-excised multi-cloning site of pcDNA3.1. The resulting NSE promoter/multicloning site/polyadenylation signal sequence cassette was excised by AflI partial digestion, the DNA fragment agarose gel purified, and then ligated (blunt end) into pShuttle cut with KpnI and SalI.
• Vector type: Mammalian Expression, Adenoviral
• Promoter: NSE

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: Low Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: Encap-F (5'-TTTGGGCGTAACCGAGTAAG-3')
• 3′ sequencing primer: pShuttle-R (5'-CACAATGCTTCCATCAAACG-3')

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA