pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6f-WPRE-pA
(Plasmid #50943)

• Purpose: Bicistronic vector expressing mRuby2 and GCaMP6f from a single open reading frame.
• Depositing Labs: Tobias Bonhoeffer, Mark Huebener, Tobias Rose
• Publication: Rose et al Science. 2016 Jun 10;352(6291):1319-22. doi: 10.1126/science.aad3358.

Backbone

• Vector backbone: pAAV
• Total vector size (bp): 6756
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Due to ease of recombination, AAV and lentivirus vectors should be amplified in a recombination deficient bacteria strain such as Invitrogen's OneShot Stbl3 cells. Check for integrety of ITR sites with SmaI digest.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: mRuby2-P2A-GCaMP6f
• Species: R. norvegicus (rat), G. gallus (chicken); ; A. victoria (jellyfish)
• Insert Size (bp): 2124
• Promoter: hSyn1

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: actcagcgctgcctcagtct
• 3′ sequencing primer: gtttgtacaaatgatgacagcgaag

Resource Information

• A portion of this plasmid was derived from a plasmid made by: mRuby2: Article: Improving FRET dynamic range with bright green and red fluorescent proteins. Lam et al (Nat Methods. 2012 Sep 9. doi: 10.1038/nmeth.2171. PubMed) Addgene Plasmid 40260 GCaMP6f: Article: Ultrasensitive fluorescent proteins for imaging neuronal activity. Chen et al (Nature. 2013 Jul 18;499(7458):295-300. doi: 10.1038/nature12354. PubMed) Addgene Plasmid 40755
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The discrepancies between the full sequence and Addgene's QC sequence should not have any functional consequence.