Skip to main content
Addgene

pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA
(Plasmid #50942)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50942 Standard format: Plasmid sent in bacteria as agar stab 1 $85
AAV1 50942-AAV1 Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. $405

Backbone

  • Vector backbone
    pAAV
  • Total vector size (bp) 6756
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Due to ease of recombination, AAV and lentivirus vectors should be amplified in a recombination deficient bacteria strain such as Invitrogen's OneShot Stbl3 cells. Check for integrety of ITR sites with SmaI digest.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    mRuby2-P2A-GCaMP6s
  • Species
    R. norvegicus (rat), G. gallus (chicken); ; A. victoria (jellyfish)
  • Insert Size (bp)
    2124
  • Promoter hSyn1

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer actcagcgctgcctcagtct
  • 3′ sequencing primer gtttgtacaaatgatgacagcgaag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    mRuby2: Article: Improving FRET dynamic range with bright green and red fluorescent proteins. Lam et al (Nat Methods. 2012 Sep 9. doi: 10.1038/nmeth.2171. PubMed) Addgene Plasmid 40260 GCaMP6s: Article: Ultrasensitive fluorescent proteins for imaging neuronal activity. Chen et al (Nature. 2013 Jul 18;499(7458):295-300. doi: 10.1038/nature12354. PubMed) Addgene Plasmid 40753
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The discrepancies between the full sequence and Addgene's QC sequence should not have any functional consequence.

Information for AAV1 (Catalog # 50942-AAV1) ( Back to top)

Purpose

Ready-to-use AAV1 particles produced from pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA (#50942). In addition to the viral particles, you will also receive purified pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA plasmid DNA.

GCaMP6s calcium sensor and bicistronic, physically separate mRuby2 expression under a human synapsin1 promoter. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
  • Buffer PBS + 0.001% Poloxamer 188
  • Serotype AAV1
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mRuby2

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA was a gift from Tobias Bonhoeffer & Mark Huebener & Tobias Rose (Addgene plasmid # 50942 ; http://n2t.net/addgene:50942 ; RRID:Addgene_50942) For viral preps, please replace (Addgene plasmid # 50942) in the above sentence with: (Addgene viral prep # 50942-AAV1)
  • For your References section:

    Cell-specific restoration of stimulus preference after monocular deprivation in the visual cortex. Rose T, Jaepel J, Hubener M, Bonhoeffer T. Science. 2016 Jun 10;352(6291):1319-22. doi: 10.1126/science.aad3358. 10.1126/science.aad3358 PubMed 27284193