-
Purposereporter for PTEN RNAi
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50936 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepsiCheck-2
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 6273
-
Vector typeMammalian Expression, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePTEN 3'UTR
-
Alt namephosphatase and tensin homolog
-
SpeciesH. sapiens (human)
-
Entrez GenePTEN (a.k.a. 10q23del, BZS, CWS1, DEC, GLM2, MHAM, MMAC1, PTEN1, PTENbeta, TEP1)
- Promoter T7
-
Tag
/ Fusion Protein
- Renilla luciferase (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer psiCHECK2-F, GTCCGCAACTACAACGCCTACCTT (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Primers used to amplify the 3'UTR of PTEN:
PTEN3′UTR-F TAGAGGAGCCGTCAAATCCA,
PTEN3′UTR-R CCCCCACTTTAGTGCACAGT,
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
psicheck2 PTEN 3'UTR was a gift from Pier Pandolfi (Addgene plasmid # 50936 ; http://n2t.net/addgene:50936 ; RRID:Addgene_50936) -
For your References section:
Coding-independent regulation of the tumor suppressor PTEN by competing endogenous mRNAs. Tay Y, Kats L, Salmena L, Weiss D, Tan SM, Ala U, Karreth F, Poliseno L, Provero P, Di Cunto F, Lieberman J, Rigoutsos I, Pandolfi PP. Cell. 2011 Oct 14;147(2):344-57. doi: 10.1016/j.cell.2011.09.029. 10.1016/j.cell.2011.09.029 PubMed 22000013