Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

psicheck2 PTEN 3'UTR
(Plasmid #50936)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50936 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    psiCheck-2
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 6273
  • Vector type
    Mammalian Expression, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PTEN 3'UTR
  • Alt name
    phosphatase and tensin homolog
  • Species
    H. sapiens (human)
  • Entrez Gene
    PTEN (a.k.a. 10q23del, BZS, CWS1, DEC, GLM2, MHAM, MMAC1, PTEN1, PTENbeta, TEP1)
  • Promoter T7
  • Tag / Fusion Protein
    • Renilla luciferase (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer psiCHECK2-F, GTCCGCAACTACAACGCCTACCTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Primers used to amplify the 3'UTR of PTEN:
PTEN3′UTR-F TAGAGGAGCCGTCAAATCCA,
PTEN3′UTR-R CCCCCACTTTAGTGCACAGT,

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psicheck2 PTEN 3'UTR was a gift from Pier Pandolfi (Addgene plasmid # 50936 ; http://n2t.net/addgene:50936 ; RRID:Addgene_50936)
  • For your References section:

    Coding-independent regulation of the tumor suppressor PTEN by competing endogenous mRNAs. Tay Y, Kats L, Salmena L, Weiss D, Tan SM, Ala U, Karreth F, Poliseno L, Provero P, Di Cunto F, Lieberman J, Rigoutsos I, Pandolfi PP. Cell. 2011 Oct 14;147(2):344-57. doi: 10.1016/j.cell.2011.09.029. 10.1016/j.cell.2011.09.029 PubMed 22000013