pLKO.1-puro U6 sgRNA SOX17 -296
(Plasmid
#50926)
-
PurposeU6 driven sgRNA targeting Sox17 -296 bp from TSS
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50926 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLKO.1
- Backbone size w/o insert (bp) 7145
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSox17-296 sgRNA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)7132
-
Entrez GeneSOX17 (a.k.a. VUR3)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA target sequence GGGCAAGTACGTCGATTCCA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1-puro U6 sgRNA SOX17 -296 was a gift from Rene Maehr & Scot Wolfe (Addgene plasmid # 50926 ; http://n2t.net/addgene:50926 ; RRID:Addgene_50926) -
For your References section:
Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Kearns NA, Genga RM, Enuameh MS, Garber M, Wolfe SA, Maehr R. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341. 10.1242/dev.103341 PubMed 24346702