pHAGE EF1α dCas9-VP64
(Plasmid #50918)

• Purpose: Constitutive dCas9-VP64 lentiviral expression vector
• Depositing Labs: Rene Maehr, Scot Wolfe
• Publication: Kearns et al Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341.

Backbone

• Vector backbone: pHAGE
• Total vector size (bp): 12806
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dCas9
• Species: S. pyogenes
• Insert Size (bp): 4406
• Mutation: D10A, H840A
• Promoter: EF1alpha
• Tags / Fusion Proteins:
  • 3xHA (C terminal on insert)
  • VP64 (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: AGAGCTCGTTTAGTGAACCG
• 3′ sequencing primer: MSCV-rev

Resource Information

• Articles Citing this Plasmid:
  • 20 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that there are several mismatches (minor deletions and insertions) between depositor's reference sequence and Addgene's quality control sequence. The mismatches are in cloning junctions/non-coding regions and should not affect plasmid function.