-
PurposeTet-regulatable dCas9-KRAB 2nd generation lentiviral expression vector
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50917 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHAGE
- Total vector size (bp) 14649
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9
-
SpeciesS. pyogenes
-
Insert Size (bp)4460
-
MutationD10A, H840A (catalytically inactive)
- Promoter TRE
-
Tags
/ Fusion Proteins
- 3xHA (C terminal on insert)
- KRAB (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer AGAGCTCGTTTAGTGAACCG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that there are several mismatches (minor deletions and insertions) between depositor's reference sequence and Addgene's quality control sequence. The mismatches are in cloning junctions/non-coding regions and should not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHAGE TRE dCas9-KRAB was a gift from Rene Maehr & Scot Wolfe (Addgene plasmid # 50917 ; http://n2t.net/addgene:50917 ; RRID:Addgene_50917) -
For your References section:
Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Kearns NA, Genga RM, Enuameh MS, Garber M, Wolfe SA, Maehr R. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341. 10.1242/dev.103341 PubMed 24346702