GANES-DEVD-BNLS
(Plasmid #50842)

• Purpose: Expresses a tandem green ddFP heterodimer in mammalian cells, construct 1 for a green to red colour switch-based fluorescent caspase-3 biosensor, used together with a second plasmid RANLS.
• Depositing Lab: Robert Campbell
• Publication: Ding et al Nat Methods. 2015 Jan 26. doi: 10.1038/nmeth.3261.

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 5500
• Total vector size (bp): 7024
• Modifications to backbone: Multi cloning sites has been replaced by a customized sequence, which is compatible to the reading frame of vector pBAD hisB.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ddGFP A and ddGFP B
• Alt name: dimerization dependent green fluorescent protein (ddGFP)
• Species: Synthetic; synthetic construct
• Insert Size (bp): 1522
• GenBank ID: KF976777
• Promoter: CMV
• Tags / Fusion Proteins:
  • triplicated NLS sequence DPKKKRKV (C terminal on insert)
  • NES sequence LALKLAGLDIGS placed after ddGFP A

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (unknown if destroyed)
• 3′ cloning site: HindIII (unknown if destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry