pCAG-GBP6-10gly-VPminx4
(Plasmid #50796)

• Purpose: Expression of a GFP-dependent transcription factor component in mammalian cells
• Depositing Lab: Connie Cepko
• Publication: Tang et al Cell. 2013 Aug 15;154(4):928-39. doi: 10.1016/j.cell.2013.07.021.

Backbone

• Vector backbone: pCAG-GFP
• Backbone size w/o insert (bp): 4823
• Total vector size (bp): 5420
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GBP6-VPminx4 activation domain fusion protein
• Alt name: ADG
• Alt name: GBP6-10gly-VPminx4
• Species: Synthetic
• Insert Size (bp): 597
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: GGACTTCCTTTGTCCCAAATCTG
• 3′ sequencing primer: TAGCCAGAAGTCAGATGCTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: GBP6 was obtained from Heinrich Leonhardt and Ulrich Rothbauer at Ludwig Maximilian University of Munich
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.

Note that GBP6 was verified in Addgene's quality control sequencing but cannot be displayed.