pGFP Cas
(Plasmid #50729)

• Purpose: mammalian expression of GFP-Cas. Note-This plasmid contains GFP21, which has a sequence similar to YFP, but emission/excitation similar to GFP.
• Depositing Lab: Kenneth Yamada
• Publication: Yamada Lab Plasmids (unpublished)

Backbone

• Vector backbone: pGZ21dxZ
• Backbone manufacturer: Yamada Lab
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cas
• Alt name: breast cancer anti-estrogen resistance 1
• Alt name: p130Cas
• Alt name: Bcar1
• Species: R. norvegicus (rat)
• Entrez Gene: Bcar1 (a.k.a. Cas, Crkas, P130CAS)
• Promoter: CMV
• Tags / Fusion Proteins:
  • GFP (N terminal on backbone)
  • FLAG (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: GFP FW (AAAGACCCCAACGAGAAGCG)
• 3′ sequencing primer: GFP ASO (TTGTAACCATTATAAGCTGC)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: cDNA was obtained from Dr. Hisamaru Hirai (Univ of Tokyo).
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry