-
Purposemammalian expression of GFP-Cas. Note-This plasmid contains GFP21, which has a sequence similar to YFP, but emission/excitation similar to GFP.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50729 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGZ21dxZ
-
Backbone manufacturerYamada Lab
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas
-
Alt namebreast cancer anti-estrogen resistance 1
-
Alt namep130Cas
-
Alt nameBcar1
-
SpeciesR. norvegicus (rat)
- Promoter CMV
-
Tags
/ Fusion Proteins
- GFP (N terminal on backbone)
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer GFP FW (AAAGACCCCAACGAGAAGCG)
- 3′ sequencing primer GFP ASO (TTGTAACCATTATAAGCTGC) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycDNA was obtained from Dr. Hisamaru Hirai (Univ of Tokyo).
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGFP Cas was a gift from Kenneth Yamada (Addgene plasmid # 50729 ; http://n2t.net/addgene:50729 ; RRID:Addgene_50729)