Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p413GPD-hTPI Lys13Arg
(Plasmid #50722)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50722 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    p413GPD
  • Backbone size w/o insert (bp) 5805
  • Total vector size (bp) 6555
  • Vector type
    Yeast Expression
  • Selectable markers
    HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Triosephosphate isomerase 1
  • Alt name
    TPI1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    750
  • Mutation
    changed Lysine 13 to Argenine
  • GenBank ID
    NM_000365.5
  • Entrez Gene
    TPI1 (a.k.a. HEL-S-49, TIM, TPI, TPID)
  • Promoter GPD

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GPD fw (ctacttgactaataagtata)
  • 3′ sequencing primer CYC Ter
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p413GPD-hTPI Lys13Arg was a gift from Markus Ralser (Addgene plasmid # 50722 ; http://n2t.net/addgene:50722 ; RRID:Addgene_50722)
  • For your References section:

    Inhibition of triosephosphate isomerase by phosphoenolpyruvate in the feedback-regulation of glycolysis. Gruning NM, Du D, Keller MA, Luisi BF, Ralser M. Open Biol. 2014 Mar 5;4(3):130232. doi: 10.1098/rsob.130232. 10.1098/rsob.130232 PubMed 24598263