p413GPD-hTPI Lys13Arg
(Plasmid #50722)

• Purpose: expression of the human TPI Lys13Arg allele in yeast
• Depositing Lab: Markus Ralser
• Publication: Gruning et al Open Biol. 2014 Mar 5;4(3):130232. doi: 10.1098/rsob.130232.

Backbone

• Vector backbone: p413GPD
• Backbone size w/o insert (bp): 5805
• Total vector size (bp): 6555
• Vector type: Yeast Expression
• Selectable markers: HIS3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Triosephosphate isomerase 1
• Alt name: TPI1
• Species: H. sapiens (human)
• Insert Size (bp): 750
• Mutation: changed Lysine 13 to Argenine
• GenBank ID: NM_000365.5
• Entrez Gene: TPI1 (a.k.a. HEL-S-49, TIM, TPI, TPID)
• Promoter: GPD

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: GPD fw (ctacttgactaataagtata)
• 3′ sequencing primer: CYC Ter

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry