pCW-Cas9
(Plasmid #50661)

• Purpose: Doxycycline-inducible lentiviral expression of SpCas9
• Depositing Labs: Eric Lander, David Sabatini
• Publication: Wang et al Science. 2014 Jan 3;343(6166):80-4. doi: 10.1126/science.1246981. Epub 2013 Dec 12.

Backbone

• Vector backbone: pCW57.1
• Backbone size w/o insert (bp): 7600
• Total vector size (bp): 11900
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: humanized S. pyogenes Cas9
• Insert Size (bp): 4300
• Promoter: Tet ON
• Tag / Fusion Protein:
  • 3xFLAG (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: AGCTCGTTTAGTGAACCGTCAGATC
• 3′ sequencing primer: CACATTCTTCACGTCCGTTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: human codon optimized 3XFLAG-SpCas9 was cloned from Plasmid 42230: pX330-U6-Chimeric_BB-CBh-hSpCas9
• Articles Citing this Plasmid:
  • 177 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Depositors used delta-VPR and CMV VSV-G packaging plasmids