pLR-NS
(Plasmid
#50619)
-
PurposeNS last repeat module plasmid for Cermak, et al., 2011 TALEN kit
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50619 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCR8
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2473
- Total vector size (bp) 2568
-
Vector typeUnspecified
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLR-NS
-
SpeciesXanthamonas
-
Insert Size (bp)95
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ApaI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer cctactcaggagagcgttca (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLR-NS was a gift from Daniel Voytas (Addgene plasmid # 50619 ; http://n2t.net/addgene:50619 ; RRID:Addgene_50619)