pZHY566
(Plasmid
#50608)
-
Purpose(Empty Backbone) TALEN expression vector for yeast, N152,C18 architecture
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50608 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTAL4
-
Backbone manufacturern/a
- Backbone size (bp) 7363
-
Vector typeYeast Expression, TALEN
- Promoter TEF
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer ttggcgtcggcaaacagtgg
- 3′ sequencing primer TCTATCCTGAGTTGAATTTCTTGCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene's quality control sequencing has found a few mismatches with the depositor's full sequence, but these discrepancies are not thought to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZHY566 was a gift from Daniel Voytas (Addgene plasmid # 50608 ; http://n2t.net/addgene:50608 ; RRID:Addgene_50608) -
For your References section:
TALENs enable efficient plant genome engineering. Zhang Y, Zhang F, Li X, Baller JA, Qi Y, Starker CG, Bogdanove AJ, Voytas DF. Plant Physiol. 2012 Nov 2. 10.1104/pp.112.205179 PubMed 23124327