-
PurposeOrigin Of Replication: p15a, Selection Markers: Amp, Promoters: PLacUV5
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50606 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRBS-01
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nametyrB
-
Insert Size (bp)1193
- Promoter lacUV5
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer TGTGGAATTGTGAGCGGATA
- 3′ sequencing primer TAATGCGGTCAATTCAGCAA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nametyrA
-
Insert Size (bp)1121
- Promoter lacUV5
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer TGTGGAATTGTGAGCGGATA
- 3′ sequencing primer ATCGACGATGCAGCCGAG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namearoC
-
Insert Size (bp)1085
- Promoter lacUV5
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer TGTGGAATTGTGAGCGGATA
- 3′ sequencing primer CCTGACGCCAGAAGCATT (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert namearoA
-
Insert Size (bp)1283
- Promoter lacUV5
Cloning Information for Gene/Insert 4
- Cloning method Unknown
- 5′ sequencing primer TGTGGAATTGTGAGCGGATA
- 3′ sequencing primer GTTAAGCGAATCGGCAAGG (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert namearoL
-
Insert Size (bp)524
- Promoter lacUV5
Cloning Information for Gene/Insert 5
- Cloning method Unknown
- 5′ sequencing primer TGTGGAATTGTGAGCGGATA
- 3′ sequencing primer TTTGAGCGTCAGATTTCGTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pY3 was a gift from Jay Keasling (Addgene plasmid # 50606 ; http://n2t.net/addgene:50606 ; RRID:Addgene_50606) -
For your References section:
Modular engineering of L-tyrosine production in Escherichia coli. Juminaga D, Baidoo EE, Redding-Johanson AM, Batth TS, Burd H, Mukhopadhyay A, Petzold CJ, Keasling JD. Appl Environ Microbiol. 2012 Jan;78(1):89-98. doi: 10.1128/AEM.06017-11. Epub 2011 Oct 21. 10.1128/AEM.06017-11 PubMed 22020510