pCFP Vinculin
(Plasmid
#50544)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50544 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCFPNBC1
-
Backbone manufacturerYamada lab
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVinculin
-
Alt nameVCL
-
Alt namefocal adhesion protein
-
SpeciesG. gallus (chicken)
-
Entrez GeneVCL (a.k.a. VINC1)
- Promoter CMV
-
Tag
/ Fusion Protein
- ECFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CFP/YFP FW (TGAGCAAAGACCCCAACGAG)
- 3′ sequencing primer EGFP RVs (CTCTACAAATGTGGTATGGCTG) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCFP Vinculin was a gift from Kenneth Yamada (Addgene plasmid # 50544 ; http://n2t.net/addgene:50544 ; RRID:Addgene_50544)